Flowchart of experimental design
Brett 6/3/10
Protocol for expressing yeast genes by tet-off pCM224/5 promoter systems, a month long affair
- 1. The paper in which this promoter system was first described is:
- Functional analysis of yeast essential genes using a promoter-substitution cassette and the tetracycline-regulatable dual expression system. Bellí G, Garí E, Aldea M, Herrero E.
- 2. Download gene sequence from SGD with at least 1 kb up and downstream of the ORF. Also download or ask Brett for pCM224, pCM225, and URA3 containing plasmid sequences. If your gene is essential and the heterozygous diploid is not haploinsufficient then you need to perform all transformations in diploids and sporulate at the end of the protocol to get haploids.
- 3. PRIMER DESIGN
Choose region of endogenous promoter to replace while leaving “enough” space to avoid screwing up neighboring ORF expression or regulation. This is essentially a guess as to how much 5’ or 3’ region of neighboring genes must remain untouched- use an ORF map to observe obvious features.
Design primers that have 20 +/- 1 bp of homology that will amplify URA3 off of a pRS plasmid and have 45 to 50 bp (more is usually better) of homology to the gene of interest. The reverse primer should have reverse complementary sequence to the start codon of the gene all the way to 45-50 bp into the ORF. The forward primer homology region should be far enough upstream (at least 200 bp to include basal transcriptional machinery binding sites) so that the sequence between the forward and reverse primer homology regions straddle the supposed endogenous promoter. This region will be homologously recombined out and replaced by URA3 during the first transformation. Check that the primer Tm’s are similar (they will be high) and that there are not secondary structures with Tm’s over 50°C. This should be done with all primers designed for this protocol.
In anticipation of the first transformation being successful, also order primers that will amplify the pCM224 or pCM225 promoters off of their respective plasmids. One primer set can be used to amplify both promoters. These primers should contain the same exact sequence homology to the gene of interest as those used to amplify URA3, but, of course, the 20 +/- 1 bp need to have homology to the pCM22x plasmids. The 5’ to 3’ homology regions that are tried and true are found below. See the end of the protocol for complete example primers used for HSF1-OE.
Design and order external verification primers that can be used along with URA3 or pCM22x internal primers for verification of transformants. Brett has pCM22x internal primers.
|
Plasmid |
F primer homology (5’ to 3’) |
R primer homology (5’ to 3’) |
|
pCM224/5 |
CAGCTGAAGCTTCGTACGC |
ATAGGCCACTAGTGGATCTG |
|
pRSxx6 (URA3 vector) |
AGATTGTACTGAGAGTGCAC |
CTGTGCGGTATTTCACACCG |
- 4. Use these primer sets to PCR amplify URA3 or pCM22x containing cassettes from their respective plasmids. Use a high fidelity polymerase such as Phusion and make multiple wells for each reaction if you are concerned about infidelity. Since the pCM22x cassettes are so large (~5 kb) they can be difficult to obtain, if you get a small amount of these products you can reamplify them by using the PCR products as template. You will want at least 50 ul of amplified cassette for transformations.
- 5. Inoculate a single colony of WT diploid or haploid cells and perform your basic integrative (non-episomal) transformation protocol using the URA3 containing cassette. This should yield transformants selectable on -URA plates that have replaced your endogenous promoter with functional URA3 by homologous recombination. I have never failed to get many transformants for this step. Verify by PCR if you feel compelled and have the time. I usually patch URA+ transformants on a -URA again to verify selection and then streak for single colonies on YPD.
- 6. Transform pCM22x containing cassettes into your favorite URA+ transformant using the integrative transformation protocol. Selection at this point is very critical- theoretically you can select for successful transformants on G418 plates since the pCM22x cassette contains KanMX, however I strongly suggest, based on experience, that you harness the power of negative selection by obtaining URA- cells on FOA plates followed by positive verification on G418 plates. Before you can select on FOA plates you must do an outgrowth on YPD plates to eliminate the pool of Ura3 enzyme in the tranformants. Following the 42°C heat shock, spin down cells and suspend them in enough water to plate them on about five YPD plates, allow these plates to grow into lawns for two days.
- 7. Replica from your YPD lawns onto FOA plates and wait at least two days before you can see colonies. Replica these onto G418 to confirm that the URA- cells contain KanMX. At this point you can streak for single colonies, PCR verify, sequence, and freeze your overexpressing haploid strain or sporulate if you have been using a diploid to obtain haploids. The promoter systems should overexpress your gene, pCM225 more than pCM224, however I find induction varies depending on the gene’s chromosomal context. If you anticipate that fully overexpressing your gene is lethal (which I doubt) then your FOA and G418 plates can be made with doxycycline in them to turn down expression.
- Example Primers
|
|
|
|
|
|
|
|
|
|